US5593841A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Nucleic acid probes for detection and/or quantitation of non-viral organisms
Assignee: Gen Probe Inc
•
Filing: 1994-12-05
•
Granted: 1997-01-14
•
Expires: 2014-12-05
Abstract
Abstract A method for preparing probes, as well as several probes for use in qualitative or quantitative hybridization assays are disclosed. The method comprises constructing an oligonucleotide that is sufficiently complementary to hybridize to a region of rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of rRNA being selected by comparing one or more variable region rRNA sequences of said non-viral organism or group of non-viral organisms with one or more variable region rRNA sequences from one or more non-viral organisms sought to be distinguished. Hybridization assay probes for Mycobacterium avium, Mycobacterium intracellulare, the Mycobacterium tuberculosis-complex bacteria, Mycoplasma pneumoniae, Legionella, Salmonella, Chlamydia trachomatis, Campylobacter, Proteus mirabilis, Enterococcus, Enterobacter cloacae, E. coli, Pseudomonas group I, Neisseria gonorrhoeae, bacteria, and fungi also are disclosed.
Inventors
- 👤 James Hogan
- 👤 Richard Smith
- 👤 Joann Kop
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-11-01 00:06
CPC Classifications
C; C12; C12Q; C12Q1/00; C12Q1/68; C12Q1/6811; C12Q1/6876; C12Q1/6888; C12Q1/689; C12Q1/6895; Y; Y02; Y02A; Y02A50/00; Y02A50/30; Y10; Y10S; Y10S435/00; Y10S435/81
Claims Analysis
Total Claims: 25
Claim 1
Independent Claim
105 words
A probe comprising an oligonucleotide 10 to 100 nucleotides in length able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions.
Claim 2
Dependent Claim
105 words
A probe comprising an oligonucleotide 10 to 100 nucleotides in length able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions.
Claim 3
Dependent Claim
30 words
The probe of claim 1, wherein said oligonucleotide comprises a sequence selected from the group consisting of: 5' ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG, and the sequence fully complementary and of the same length thereto.
Claim 4
Dependent Claim
18 words
The probe of claim 1, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.
Claim 5
Dependent Claim
34 words
The probe of claim 1, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of: 5' ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG, and the sequence perfectly complementary thereto.
Claim 6
Dependent Claim
30 words
The probe of any of claims 1, 3 or 4, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.
Claim 7
Dependent Claim
23 words
The probe of claim 5, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.
Claim 8
Dependent Claim
18 words
The probe of any of claims 1, 3 or 4, wherein said oligonucleotide is 15-50 bases in length.
Claim 9
Dependent Claim
40 words
The probe of claim 5, wherein said selective hybridization assay conditions comprise 0.12M phosphate buffer containing equimolar amounts of Na 2 HPO 4 and NaH 2 PO 4 , 1 mM EDTA and 0.02% sodium dodecyl sulfate at 65° C.
Claim 10
Dependent Claim
105 words
A probe comprising an oligonucleotide 15 to 100 nucleotides in length able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 15 contiguous nucleonides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions.
Claim 11
Dependent Claim
105 words
A probe comprising an oligonucleotide 15 to 100 nucleotides in length able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 15 contiguous nucleonides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions.
Claim 12
Dependent Claim
18 words
The probe of claim 9, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.
Claim 13
Dependent Claim
32 words
The probe of claim 9, wherein said 15 contiguous base region is present in a nucleic acid sequence selected from the group consisting of: 5' ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG, and the sequence perfectly complementary thereto.
Claim 14
Dependent Claim
27 words
The probe of any of claims 9-11, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 15 contiguous nucleotides.
Claim 15
Dependent Claim
23 words
The probe of claim 12, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 15 contiguous nucleotides.
Claim 16
Dependent Claim
40 words
The probe of claim 13, wherein said selective hybridization assay conditions comprise 0.12M phosphate buffer containing equimolar amounts of Na 2 HPO 4 and NaH 2 PO 4 , 1 mM EDTA and 0.02% sodium dodecyl sulfate at 65° C.
Claim 17
Dependent Claim
13 words
The probe of claim 12, wherein said oligonucleotide is 15-50 bases in length.
Claim 18
Independent Claim
138 words
A method for determining whether Mycobacterium avium may be present in a sample comprising the steps of: a) providing to said sample a probe comprising an oligonucleotide able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions, and b) detecting hybridization of said oligonucleotide to nucleic acid present in said sample under said hybridization conditions.
Claim 19
Independent Claim
138 words
A method for determining whether Mycobacterium avium may be present in a sample comprising the steps of: a) providing to said sample a probe comprising an oligonucleotide able to hybridize to a Mycobacterium avium nucleic acid target region to form a detectable target:probe duplex under hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region and said oligonucleotide does not hybridize to nucleic acid from either Mycobacterium intracellulare or Mycobacterium tuberculosis to form a detectable non-target:probe duplex under said hybridization conditions, and b) detecting hybridization of said oligonucleotide to nucleic acid present in said sample under said hybridization conditions.
Claim 20
Dependent Claim
30 words
The method of claim 16, wherein said oligonucleotide comprises a sequence selected from the group consisting of: 5' ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG, and the sequence of the same length and fully complementary thereto.
Claim 21
Dependent Claim
18 words
The method of claim 16, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.
Claim 22
Dependent Claim
34 words
The method of claim 16, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of: 5' ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG, and the sequence perfectly complementary thereto.
Claim 23
Independent Claim
30 words
The method of any of claims 16, 18 or 19, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.
Claim 24
Dependent Claim
23 words
The method of claim 20, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.
Claim 25
Dependent Claim
13 words
The method of claim 20, wherein said oligonucleotide is 15-50 bases in length.
References Cited (Backward Citations)
US3755086A
Cited
US3930956A
Cited
US4237224A
Cited
US4033143A
Cited
US4275149A
Cited
US4302204A
Cited
US4228238A
Cited
US4358535A
Cited
US4358535B1
Cited
US4394443A
Cited
US4416988A
Cited
EP0155360A1
Cited
US4717653A
Cited
US5087558A
Cited
WO1983001073A1
Cited
EP0155359A1
Cited
US5348854A
Cited
EP0079139A1
Cited
US4480040A
Cited
WO1984001174A1
Cited
US5288611A
Cited
WO1984002721A1
Cited
US4851330A
Cited
US4689295A
Cited
EP0120658A2
Cited
AU3138784A
Cited
EP0133671A2
Cited
US4677054A
Cited
EP0232085A2
Cited
EP0245129A1
Cited
EP0250662A1
Cited
EP0277237A1
Cited
WO1988003957A1
Cited
US5217862A
Cited
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 2000-01-14 | 2000-07-15 | 2001-01-14 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 2004-01-14 | 2004-07-15 | 2005-01-14 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 2008-01-14 | 2008-07-15 | 2009-01-14 | $7700.00 | Window Closed / Lapsed |