Patent EP0272009A2 successfully refreshed from Google Patents.
EP0272009A2
Expired / Lapsed
EP
⏱️ 0.0 years remaining
Nucleic acid probes for detection and/or quantitation of non-viral organisms
Assignee: Gen Probe Inc
•
Filing: 1987-11-24
•
Granted: —
•
Expires: 2007-11-24
Abstract
Abstract A method for preparing probes, as well as several probes for use in qualitative or quantitative hybridization assays are disclosed. The method comprises constructing an oligonucleotide that is sufficiently complementary to hybridize to a region of rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of rRNA being selected by comparing one or more variable region rRNA sequences of said non-viral organism or group of non-viral organisms with one or more variable region rRNA sequences from one or more non-viral organisms sought to be distinguished. Hybridization assay probes for Mycobacterium avium , Mycobacterium intracellulare , the Mycobacterium tuberculosis -complex bacteria, Mycoplasma pneumoniae , Legionella , Salmonella , Chlamydia trachomatis , Campylobacter , Proteus mirabilis , Enterococcus , Enterobacter cloacae , E. coli , Pseudomonas group I , Neisseria gonorrhoeae , bacteria, and fungi also are disclosed.
Inventors
- 👤 James John Hogan
- 👤 Richard Dana Smith
- 👤 Jo Ann Kop
- 👤 Sherrol Hoffa Mcdonough
Bibliographic Details
Application Number
—
Jurisdiction
EP
Data Source
google_patents
Last Synchronized
2026-10-29 06:30
CPC Classifications
C; C12; C12Q; C12Q1/00; C12Q1/68; C12Q1/6876; C12Q1/6888; C12Q1/689
Claims Analysis
Total Claims: 436
Claim 1
Independent Claim
91 words
A method for preparing a probe for use in a qualitative or quantitative hybridization assay which comprises constructing an oligonucleotide that is sufficiently complementary to hybridize to a region of rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of rRNA being selected by comparing one or more variable region rRNA sequences of said non-viral organism or group of non-viral organisms with one or more variable region rRNA sequences from one or more non-viral organisms sought to be distinguished therefrom.
Claim 2
Independent Claim
91 words
A method for preparing a probe for use in a qualitative or quantitative hybridization assay which comprises constructing an oligonucleotide that is sufficiently complementary to hybridize to a region of rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of rRNA being selected by comparing one or more variable region rRNA sequences of said non-viral organism or group of non-viral organisms with one or more variable region rRNA sequences from one or more non-viral organisms sought to be distinguished therefrom.
Claim 3
Dependent Claim
38 words
The method of claim 1 wherein said variable region rRNA sequences from non-viral organisms sought to be distinguished are from the known nearest related organism to said non-viral organism or group of non-viral organisms sought to be detected.
Claim 4
Dependent Claim
46 words
The method of claim 1 wherein said region of rRNA is selected to have at least about a one base sequence difference from a corresponding rRNA sequence of the known nearest related organism to said non-viral organism or group of non-viral organisms sought to be detected.
Claim 5
Dependent Claim
48 words
The method of claim 1 wherein said region of rRNA is selected to have at least about a 10% or greater base sequence difference from the corresponding rRNA sequence of the known nearest related organism to said non-viral organism or group of non-viral organisms sought to be detected.
Claim 6
Dependent Claim
22 words
The method of claim 1 wherein said region of rRNA is chosen from the group consisting of 5S, 16S, and 23S rRNA.
Claim 7
Dependent Claim
23 words
The method of claim 1 wherein said region of rRNA is chosen from the group consisting of 5.0S, 5.8S, 18S and 28S rRNA.
Claim 8
Dependent Claim
16 words
The method of claim 1 wherein said oligonucleotide is at least about 10 nucleotides in length.
Claim 9
Dependent Claim
16 words
The method of claim 1 wherein said oligonucleotide is at least about 15 nucleotides in length.
Claim 10
Dependent Claim
16 words
The method of claim 1 wherein said oligonucleotide is at least about 20 nucleotides in length.
Claim 11
Dependent Claim
16 words
The method of claim 1 wherein said oligonucleotide is at least about 30 nucleotides in length.
Claim 12
Dependent Claim
18 words
The method of claim 1 wherein said oligonucleotide is about 20 nucleotides to about 50 nucleotides in length.
Claim 13
Dependent Claim
18 words
The method of claim 1 wherein said oligonucleotide is about 30 nucleotides to about 50 nucleotides in length.
Claim 14
Dependent Claim
16 words
The method of claim 3 wherein said oligonucleotide is at least about 10 nucleotides in length.
Claim 15
Dependent Claim
16 words
The method of claim 3 wherein said oligonucleotide is at least about 15 nucleotides in length.
Claim 16
Dependent Claim
16 words
The method of claim 1 wherein said oligonucleotide is at least about 20 nucleotides in length.
Claim 17
Dependent Claim
16 words
The method of claim 3 wherein said oligonucleotide is at least about 30 nucleotides in length.
Claim 18
Dependent Claim
18 words
The method of claim 3 wherein said oligonucleotide is about 20 nucleotides to about 50 nucleotides in length.
Claim 19
Dependent Claim
19 words
The method of claim 3 wherein said oligonucleotide is at about 30 nucleotides to about 50 nucleotides in length.
Claim 20
Dependent Claim
16 words
The method of claim 4 wherein said oligonucleotide is at least about 10 nucleotides in length.
Claim 21
Dependent Claim
16 words
The method of claim 4 wherein said oligonucleotide is at least about 15 nucleotides in length.
Claim 22
Dependent Claim
16 words
The method of claim 4 wherein said oligonucleotide is at least about 20 nucleotides in length.
Claim 23
Dependent Claim
16 words
The method of claim 4 wherein said oligonucleotide is at least about 30 nucleotides in length.
Claim 24
Dependent Claim
18 words
The method of claim 4 wherein said oligonucleotide is about 20 nucleotides to about 50 nucleotides in length.
Claim 25
Dependent Claim
18 words
The method of claim 4 wherein said oligonucleotide is about 30 nucleotides to about 50 nucleotides in length.
Claim 26
Dependent Claim
19 words
The method of claim 1 wherein said probe is at least about 75% complementary to said region of rRNA.
Claim 27
Dependent Claim
19 words
The method of claim 3 wherein said oligonucleotide is at least about 75% complementary to said region of rRNA.
Claim 28
Dependent Claim
19 words
The method of claim 4 wherein said oligonucleotide is at least about 75% complementary to said region of rRNA.
Claim 29
Dependent Claim
16 words
The method of claim 1 wherein said probe is perfectly complementary to said region of rRNA.
Claim 30
Dependent Claim
16 words
The method of claim 3 wherein said probe is perfectly complementary to said region of rRNA.
Claim 31
Dependent Claim
16 words
The method of claim 4 wherein said probe is perfectly complementary to said region of rRNA.
Claim 32
Dependent Claim
50 words
A hybridization assay probe for a non-viral organism or organisms comprising an oligonucleotide of at least about 10 nucleotides in length wherein at least about 10 contiguous nucleotides are substantially complementary to at least one variable region of nucleic acid selected to be unique to said non-viral organism or organisms.
Claim 33
Dependent Claim
50 words
A hybridization assay probe for a non-viral organism or organisms comprising an oligonucleotide of at least about 10 nucleotides in length wherein at least about 10 contiguous nucleotides are substantially complementary to at least one variable region of nucleic acid selected to be unique to said non-viral organism or organisms.
Claim 34
Dependent Claim
47 words
A hybridization assay probe for a non-viral organism or organisms comprising an oligonucleotide of at least about 10 nucleotides in length which is at least about 75% complementary to at least one variable region of nucleic acid selected to be unique to said non-viral organism or organisms.
Claim 35
Dependent Claim
47 words
A hybridization assay probe for a non-viral organism or organisms comprising an oligonucleotide of at least about 10 nucleotides in length which is at least about 75% complementary to at least one variable region of nucleic acid selected to be unique to said non-viral organism or organisms.
Claim 36
Dependent Claim
17 words
The probe of claim 31 or 32 wherein said nucleic acid is 5S, 16S, or 23S rRNA.
Claim 37
Dependent Claim
18 words
The probe of claim 31 or 32 wherein said nucleic acid is 5.0S, 5.8S, 18S, or 28S rRNA.
Claim 38
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Mycobacterium avium .
Claim 39
Dependent Claim
12 words
The probe of claim 35 wherein said oligonucleotide comprises the sequence ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG.
Claim 40
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 36 or to the complement thereof.
Claim 41
Dependent Claim
20 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG and a nucleic acid sequence substantially complementary thereto.
Claim 42
Dependent Claim
20 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG and a nucleic acid sequence substantially complementary thereto.
Claim 43
Dependent Claim
11 words
A nucleotide polymer of the structure ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG and the complement thereto.
Claim 44
Dependent Claim
11 words
A nucleotide polymer of the structure ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG and the complement thereto.
Claim 45
Dependent Claim
25 words
A nucleotide polymer capable of hybriding to RNA of the species Mycobacterium avium in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 46
Dependent Claim
25 words
A nucleotide polymer capable of hybriding to RNA of the species Mycobacterium avium in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 47
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 40 and a nucleic acid sequence substantially complementary thereto.
Claim 48
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Mycobacterium intracellulare .
Claim 49
Dependent Claim
12 words
The probe of claim 42 wherein said oligonucleotide comprises the sequence ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG.
Claim 50
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 43 or to the complement thereof.
Claim 51
Dependent Claim
20 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG and a nucleic acid sequence substantially complementary thereto.
Claim 52
Dependent Claim
20 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG and a nucleic acid sequence substantially complementary thereto.
Claim 53
Dependent Claim
11 words
A nucleotide polymer of the structure ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG and the complement thereto.
Claim 54
Dependent Claim
11 words
A nucleotide polymer of the structure ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG and the complement thereto.
Claim 55
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycobacterium intracellulare in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 56
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycobacterium intracellulare in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 57
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 47 and a nucleic acid sequence substantially complementary thereto.
Claim 58
Dependent Claim
15 words
The probe of claim 31 wherein said non-viral organisms are the Mycobacterium tuberculosis -complex bacteria.
Claim 59
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprises the sequence TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG.
Claim 60
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprises the sequence TGCCCTACCCACACCCACCACCAGGTGATGT.
Claim 61
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprises the sequence CCATCACCACCCTCCTCCGGAGAGGAAAAGG.
Claim 62
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprises the sequence CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC.
Claim 63
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprise the sequence AGGCACTGTCCCTAAACCCGATTCAGGGTTC.
Claim 64
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprises the sequence CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG.
Claim 65
Dependent Claim
12 words
The probe of claim 49 wherein said oligonucleotide comprise the sequence ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC.
Claim 66
Dependent Claim
29 words
A nucleotide polymer capable of hybridizing to the probe of claims 50 or 51 or 52 or 53 or 54 or 55 or 56 or to the complement thereof.
Claim 67
Dependent Claim
36 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG, TGCCCTACCCACACCCACCACAAGGTGATGT, CCATCACCACCCTCCTCCGGAGAGGAAAAGG, CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC, AGGCACTGTCCCTAAACCCGATTCAGGGTTC, CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG, and ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC; and a nucleic acid sequence substantially complementary thereto.
Claim 68
Dependent Claim
36 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG, TGCCCTACCCACACCCACCACAAGGTGATGT, CCATCACCACCCTCCTCCGGAGAGGAAAAGG, CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC, AGGCACTGTCCCTAAACCCGATTCAGGGTTC, CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG, and ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC; and a nucleic acid sequence substantially complementary thereto.
Claim 69
Dependent Claim
28 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG, TGCCCTACCCACACCCACCACAAGGTGATGT, CCATCACCACCCTCCTCCGGAGAGGAAAAGG, CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC, AGGCACTGTCCCTAAACCCGATTCAGGGTTC, CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG, and ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC; and the complements thereto.
Claim 70
Dependent Claim
28 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG, TGCCCTACCCACACCCACCACAAGGTGATGT, CCATCACCACCCTCCTCCGGAGAGGAAAAGG, CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC, AGGCACTGTCCCTAAACCCGATTCAGGGTTC, CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG, and ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC; and the complements thereto.
Claim 71
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the rRNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 72
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the rRNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 185-225 of E. coli 16S rRNA.
Claim 73
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 60 and a nucleic acid substantially comple-mentary thereto.
Claim 74
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 540-575 of E. coli 23S rRNA.
Claim 75
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 540-575 of E. coli 23S rRNA.
Claim 76
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 62 and a nucleic acid substantially complement-ary thereto.
Claim 77
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 1155-1190 of E. coli 23S rRNA.
Claim 78
Dependent Claim
30 words
A nucleotide polymer capable of hybridizing to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 1155-1190 of E. coli 23S rRNA.
Claim 79
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 64 and a nucleic acid substantially complemen-tary thereto.
Claim 80
Dependent Claim
30 words
A nucleotide polymer capable of hybriding to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 2195-2235 of E. coli 23S rRNA.
Claim 81
Dependent Claim
30 words
A nucleotide polymer capable of hybriding to the RNA of the species included in the Mycobacterium tuberculosis complex in the region corresponding to bases 2195-2235 of E. coli 23S rRNA.
Claim 82
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 66 and a nucleic acid substantially complemen-tary thereto.
Claim 83
Dependent Claim
14 words
The probe of claim 31 wherein said non-viral organisms are the genus Mycobacterium .
Claim 84
Dependent Claim
21 words
The probe of claim 68 wherein said oligonucleotide comprises the sequence CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG.
Claim 85
Dependent Claim
22 words
The probe of claim 68 wherein said oligonucleotide comprises the sequence GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG.
Claim 86
Dependent Claim
23 words
The probe of claim 68 wherein said oligonucleotide comprises the sequence CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC.
Claim 87
Dependent Claim
22 words
The probe of claim 68 wherein said oligonucleotide comprises the sequence GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC.
Claim 88
Dependent Claim
23 words
A nucleotide polymer capable of hybridizing to the probe of claims 69 or 70 or 71 or 72 or to the complement thereof.
Claim 89
Dependent Claim
73 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG, GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG, CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC, and GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC; and a nucleic acid sequence substantially complementary thereto.
Claim 90
Dependent Claim
73 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG, GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG, CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC, and GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC; and a nucleic acid sequence substantially complementary thereto.
Claim 91
Dependent Claim
65 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG, GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG, CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC, and GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC; and the complements thereto.
Claim 92
Dependent Claim
65 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG, GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG, CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC, and GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC; and the complements thereto.
Claim 93
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1025-1060 of E. coli 16S rRNA.
Claim 94
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1025-1060 of E. coli 16S rRNA.
Claim 95
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 76 and a nucleic acid sequence substantially complementary thereto.
Claim 96
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1440-1475 of E. coli 23S rRNA.
Claim 97
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1440-1475 of E. coli 23S rRNA.
Claim 98
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 78 and a nucleic acid sequence substantially complementary thereto.
Claim 99
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1515-1555 of E. coli 23S rRNA.
Claim 100
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1515-1555 of E. coli 23S rRNA.
Claim 101
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 80 and a nucleic acid sequence substantially complementary thereto.
Claim 102
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1570-1610 of E. coli 23S rRNA.
Claim 103
Dependent Claim
24 words
A nucleotide polymer capable of hybridizing to RNA of the genus Mycobacterium in the region corresponding to bases 1570-1610 of E. coli 23S rRNA.
Claim 104
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 82 and a nucleic acid sequence substantially complementary thereto.
Claim 105
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Mycoplasm pneumoniae .
Claim 106
Dependent Claim
12 words
The probe of claim 84 wherein said oligonucleotide comprises the sequence GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC.
Claim 107
Dependent Claim
12 words
The probe of claim 84 wherein said oligonucleotide comprises the sequence AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT.
Claim 108
Dependent Claim
12 words
The probe of claim 84 wherein said oligonucleotide comprises the sequence CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT.
Claim 109
Dependent Claim
12 words
The probe of claim 84 wherein said oligonucleotide comprise the sequence TACCGAGGGGATCGCCCCGACAGCTAGTAT.
Claim 110
Dependent Claim
12 words
The probe of claim 84 wherein said oligonucleotide comprises the sequence CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC.
Claim 111
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the probes of claims 85 to 86 or 87 or 88 or 89 or to the complement thereof.
Claim 112
Dependent Claim
34 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC, AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT, CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT, TACCGAGGGGATCGCCCCGACAGCTAGTAT, and CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC; and a nucleic acid sequence substantially complementary thereto.
Claim 113
Dependent Claim
34 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC, AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT, CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT, TACCGAGGGGATCGCCCCGACAGCTAGTAT, and CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC; and a nucleic acid sequence substantially complementary thereto.
Claim 114
Dependent Claim
26 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC, AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT, CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT, TACCGAGGGGATCGCCCCGACAGCTAGTAT, and CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC; and the complements thereto.
Claim 115
Dependent Claim
26 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC, AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT, CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT, TACCGAGGGGATCGCCCCGACAGCTAGTAT, and CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC; and the complements thereto.
Claim 116
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 190-230 of E. coli 16S rRNA.
Claim 117
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 190-230 of E. coli 16S rRNA.
Claim 118
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 93 and a nucleic acid sequence substantially complementary thereto.
Claim 119
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 450-490 of E. coli 16S rRNA.
Claim 120
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 450-490 of E. coli 16S rRNA.
Claim 121
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 95 and a nucleic acid sequence substantially complementary thereto.
Claim 122
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 820-860 of E. coli 16S rRNA.
Claim 123
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 820-860 of E. coli 16S rRNA.
Claim 124
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 97 and a nucleic acid sequence substantially complementary thereto.
Claim 125
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 1255-1290 of E. coli 16S rRNA.
Claim 126
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 1255-1290 of E. coli 16S rRNA.
Claim 127
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 99 and a nucleic acid sequence substantially complementary thereto.
Claim 128
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 65-120 of E. coli 5S rRNA.
Claim 129
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Mycoplasma pneumoniae in the region corresponding to bases 65-120 of E. coli 5S rRNA.
Claim 130
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 101 and a nucleic acid sequence substantially complementary thereto.
Claim 131
Dependent Claim
14 words
The probe of claim 31 wherein said non-viral organisms are the genus Legionella .
Claim 132
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC.
Claim 133
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC.
Claim 134
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG.
Claim 135
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence GCGGTACGGTTCTCTATAAGTTATGGCTAGC.
Claim 136
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence GTACCGAGGGTACCTTTGTGCT.
Claim 137
Dependent Claim
12 words
The probe of claim 103 wherein said oligonucleotide comprises the sequence CACTCTTGGTACGATGTCCGAC.
Claim 138
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the probes of claims 104 or 105 or 106 or 107 or 108 or 109 or to the complement thereof.
Claim 139
Dependent Claim
35 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC, GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC, CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG, GCTGTACGGTTCTCTATAATGTATGGCTAGC, GTACCGAGGGTACCTTTGTGCT, and CACTCTTGGTACGATGTCCGAC; and a nucleic acid sequence substantially complementary thereto.
Claim 140
Dependent Claim
35 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC, GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC, CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG, GCTGTACGGTTCTCTATAATGTATGGCTAGC, GTACCGAGGGTACCTTTGTGCT, and CACTCTTGGTACGATGTCCGAC; and a nucleic acid sequence substantially complementary thereto.
Claim 141
Dependent Claim
27 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC, GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC, CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG, GCGGTACGGTTCTCTATAAGTTATGGCTAGC, GTACCGAGGGTACCTTTGTGCT, and CACTCTTGGTACGATGTCCGAC; and the complements thereto.
Claim 142
Dependent Claim
27 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC, GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC, CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG, GCGGTACGGTTCTCTATAAGTTATGGCTAGC, GTACCGAGGGTACCTTTGTGCT, and CACTCTTGGTACGATGTCCGAC; and the complements thereto.
Claim 143
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 630-675 of E. coli 16S rRNA.
Claim 144
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 630-675 of E. coli 16S rRNA.
Claim 145
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 113 and a nucleic acid sequence substantially complementary thereto.
Claim 146
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 975-1020 of E. coli 16S rRNA.
Claim 147
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 975-1020 of E. coli 16S rRNA.
Claim 148
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 115 and a nucleic acid sequence substantially complementary thereto.
Claim 149
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 350-395 of E. coli 23S rRNA.
Claim 150
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 350-395 of E. coli 23S rRNA.
Claim 151
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 117 and a nucleic acid sequence substantially complementary thereto.
Claim 152
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 1585-1620 of E. coli 23S rRNA.
Claim 153
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 1585-1620 of E. coli 23S rRNA.
Claim 154
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 119 and a nucleic acid sequence substantially complementary thereto.
Claim 155
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 2280-2330 of E. coli 23S rRNA.
Claim 156
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Legionella in the region corresponding to bases 2280-2330 of E. coli 23S rRNA.
Claim 157
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 121 and a nucleic acid sequence substantially complementary thereto.
Claim 158
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Chlamydia trachomatis .
Claim 159
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CCGACTCGGGGTTGAGCCCATCTTTGACAA.
Claim 160
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence TTACGTCCGACACGGATGGGGTTGAGACCATC.
Claim 161
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CCGCCACTAAACAATCGTCGAAACAATTGCTCCGTTCGA.
Claim 162
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CGTTACTCGGATGCCCAAATATCGCCACATTCG.
Claim 163
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGATCC.
Claim 164
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence GAGGTCGGTCTTTCTCTCCTTTCGTCTACG.
Claim 165
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CCGTTCTCATCGCTCTACGGACTCTTCCAATCG.
Claim 166
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CGAAGATTCCCCTTGATCGCGACCTGATCT.
Claim 167
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence CCGGGGCTCCTATCGTTCCATAGTCACCCTAAAAG.
Claim 168
Dependent Claim
12 words
The probe of claim 123 wherein said oligonucleotide comprises the sequence TACCGCGTGTCTTATCGACACACCCGCG.
Claim 169
Dependent Claim
35 words
A nucleotide polymer capable of hybridizing to the probe of claims 124 or 125 or 126 or 127 or 128 or 129 or 130 or 131 or 132 or 133 or to the complement thereof.
Claim 170
Dependent Claim
39 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCGACTCGGGGTTGAGCCCATCTTTGACAA, TTACGTCCGACACGGATGGGGTTGAGACCATC, CCGCCACTAAACAATCGTCGAAACAATTGCTCCGTTCGA, CGTTACTCGGATGCCCAAATATCGCCACATTCG, CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGATCC, GAGGTCGGTCTTTCTCTCCTTTCGTCTACG, CCGTTCTCATCGCTCTACGGACTCTTCCAATCG, CGAAGATTCCCCTTGATCGCGACCTGATCT, CCGGGGCTCCTATCGTTCCATAGTCACCCTAAAAG, and TACCGCGTGTCTTATCGACACACCCGCG; and a nucleic acid sequence substantially complementary thereto.
Claim 171
Dependent Claim
39 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCGACTCGGGGTTGAGCCCATCTTTGACAA, TTACGTCCGACACGGATGGGGTTGAGACCATC, CCGCCACTAAACAATCGTCGAAACAATTGCTCCGTTCGA, CGTTACTCGGATGCCCAAATATCGCCACATTCG, CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGATCC, GAGGTCGGTCTTTCTCTCCTTTCGTCTACG, CCGTTCTCATCGCTCTACGGACTCTTCCAATCG, CGAAGATTCCCCTTGATCGCGACCTGATCT, CCGGGGCTCCTATCGTTCCATAGTCACCCTAAAAG, and TACCGCGTGTCTTATCGACACACCCGCG; and a nucleic acid sequence substantially complementary thereto.
Claim 172
Dependent Claim
31 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCGACTCGGGGTTGAGCCCATCTTTGACAA, TTACGTCCGACACGGATGGGGTTGAGACCATC, CCGCCACTAAACAATCGTCGAAACAATTGCTCCGTTCGA, CGTTACTCGGATGCCCAAATATCGCCACATTCG, CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGATCC, GAGGTCGGTCTTTCTCTCCTTTCGTCTACG, CCGTTCTCATCGCTCTACGGACTCTTCCAATCG, CGAAGATTCCCCTTGATCGCGACCTGATCT, CCGGGGCTCCTATCGTTCCATAGTCACCCTAAAAG, and TACCGCGTGTCTTATCGACACACCCGCG; and the complements thereto.
Claim 173
Dependent Claim
31 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCGACTCGGGGTTGAGCCCATCTTTGACAA, TTACGTCCGACACGGATGGGGTTGAGACCATC, CCGCCACTAAACAATCGTCGAAACAATTGCTCCGTTCGA, CGTTACTCGGATGCCCAAATATCGCCACATTCG, CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGATCC, GAGGTCGGTCTTTCTCTCCTTTCGTCTACG, CCGTTCTCATCGCTCTACGGACTCTTCCAATCG, CGAAGATTCCCCTTGATCGCGACCTGATCT, CCGGGGCTCCTATCGTTCCATAGTCACCCTAAAAG, and TACCGCGTGTCTTATCGACACACCCGCG; and the complements thereto.
Claim 174
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 60-105 of E. coli 16S rRNA.
Claim 175
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 60-105 of E. coli 16S rRNA.
Claim 176
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 137 and a nucleic acid substantially complemen-tary thereto.
Claim 177
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 175-210 of E. coli 16S rRNA.
Claim 178
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 175-210 of E. coli 16S rRNA.
Claim 179
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 139 and a nucleic acid substantially complemen-tary thereto.
Claim 180
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 600-635 of E. coli 16S rRNA.
Claim 181
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 600-635 of E. coli 16S rRNA.
Claim 182
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 141 and a nucleic acid substantially complemen-tary thereto.
Claim 183
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 830-870 of E. coli 16S rRNA.
Claim 184
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 830-870 of E. coli 16S rRNA.
Claim 185
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 143 and a nucleic acid substantially complemen-tary thereto.
Claim 186
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 275-320 of E. coli 23S rRNA.
Claim 187
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 275-320 of E. coli 23S rRNA.
Claim 188
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 145 and a nucleic acid substantially complemen-tary thereto.
Claim 189
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 330-365 of E. coli 23S rRNA.
Claim 190
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 330-365 of E. coli 23S rRNA.
Claim 191
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 147 and a nucleic acid substantially complemen-tary thereto.
Claim 192
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1160-1190 of E. coli 23S rRNA.
Claim 193
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1160-1190 of E. coli 23S rRNA.
Claim 194
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 149 and a nucleic acid substantially complemen-tary thereto.
Claim 195
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1450-1490 of E. coli 23S rRNA.
Claim 196
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1450-1490 of E. coli 23S rRNA.
Claim 197
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 151 and a nucleic acid substantially complemen-tary thereto.
Claim 198
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1510-1545 of E. coli 23S rRNA.
Claim 199
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1510-1545 of E. coli 23S rRNA.
Claim 200
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 153 and a nucleic acid substantially complemen-tary thereto.
Claim 201
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1710-1750 of E. coli 23S rRNA.
Claim 202
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Chlamydia trachomatis in the region corresponding to bases 1710-1750 of E. coli 23S rRNA.
Claim 203
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 155 and a nucleic acid substantially complemen-tary thereto.
Claim 204
Dependent Claim
12 words
The probe of claim 31 wherein said non-viral organism is Campylobacter .
Claim 205
Dependent Claim
19 words
The probe of claim 157 wherein said oligonucleotide comprises the sequence CGC TCC GAA AAG TGT CAT CCT CC.
Claim 206
Dependent Claim
20 words
The probe of claim 157 wherein said oligonucleotide comprises the sequence CCT TAG GTA CCG TCA GAA TTC TTC CC.
Claim 207
Dependent Claim
19 words
The probe of claim 157 wherein said oligonucleotide comprises the sequence GCC TTC GCA ATG GGT ATT CTT GGTG.
Claim 208
Dependent Claim
19 words
The probe of claim 157 wherein said oligonucleotide comprises the sequence GGT TCT TAG GAT ATC AAG CCC AGG.
Claim 209
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the probes of claims 158 or 159 or 160 or 161 or 157 or to the complement thereof.
Claim 210
Dependent Claim
55 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CGC TCC GAA AAG TGT CAT CCT CC, CCT TAG GTA CCG TCA GAA TTC TTC CC, GCCTTCGCAATGGGTATTCTTGGTG, and GGT TCT TAG GAT ATC AAG CCC AGG; and a nucleic acid sequence substantially complementary thereto.
Claim 211
Dependent Claim
55 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CGC TCC GAA AAG TGT CAT CCT CC, CCT TAG GTA CCG TCA GAA TTC TTC CC, GCCTTCGCAATGGGTATTCTTGGTG, and GGT TCT TAG GAT ATC AAG CCC AGG; and a nucleic acid sequence substantially complementary thereto.
Claim 212
Dependent Claim
47 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CGC TCC GAA AAG TGT CAT CCT CC, CCT TAG GTA CCG TCA GAA TTC TTC CC, GCCTTCGCAATGGGTATTCTTGGTG, and GGT TCT TAG GAT ATC AAG CCC AGG; and the complements thereto.
Claim 213
Dependent Claim
47 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CGC TCC GAA AAG TGT CAT CCT CC, CCT TAG GTA CCG TCA GAA TTC TTC CC, GCCTTCGCAATGGGTATTCTTGGTG, and GGT TCT TAG GAT ATC AAG CCC AGG; and the complements thereto.
Claim 214
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 405-428 of E. coli 16S rRNA.
Claim 215
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 405-428 of E. coli 16S rRNA.
Claim 216
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 165 and a nucleic acid substantially complemen-tary thereto.
Claim 217
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 440-475 of E. coli 16S rRNA.
Claim 218
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 440-475 of E. coli 16S rRNA.
Claim 219
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 167 and a nucleic acid sequence complemen-tary thereto.
Claim 220
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 705-735 of E. coli 16S rRNA.
Claim 221
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 705-735 of E. coli 16S rRNA.
Claim 222
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 169 and a nucleic acid substantially complemen-tary thereto.
Claim 223
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 980-1010 of E. coli 16S rRNA.
Claim 224
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Campylobacter in the region corresponding to bases 980-1010 of E. coli 16S rRNA.
Claim 225
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 171 and a nucleic acid sequence substantially complementary thereto.
Claim 226
Dependent Claim
19 words
The probe of claim 31 wherein said non-viral organisms are the sub-generic group of Streptococci known as enterococci .
Claim 227
Dependent Claim
23 words
The probe of claim 173 wherein said oligonucleotide comprises the sequence TGC AGC ACT GAA GGG CGG AAA CCC TCC AAC ACT TA.
Claim 228
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 174 or to the complement thereof.
Claim 229
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence TGC AGC ACT GAA GGG CGG AAA CCC TCC AAC ACT TA and a nucleic acid sequence substantially complementary.
Claim 230
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence TGC AGC ACT GAA GGG CGG AAA CCC TCC AAC ACT TA and a nucleic acid sequence substantially complementary.
Claim 231
Dependent Claim
22 words
A nucleotide polymer of the structure TGC AGC ACT GAA GGG CGG AAA CCC TCC AAC ACT TA and the complement thereto.
Claim 232
Dependent Claim
22 words
A nucleotide polymer of the structure TGC AGC ACT GAA GGG CGG AAA CCC TCC AAC ACT TA and the complement thereto.
Claim 233
Dependent Claim
29 words
A nucleotide polymer capable of hybridizing to the RNA of the sub-generic group Streptococci known as enterococci in the region corresponding to bases 825-860 of E. coli 16S rRNA.
Claim 234
Dependent Claim
29 words
A nucleotide polymer capable of hybridizing to the RNA of the sub-generic group Streptococci known as enterococci in the region corresponding to bases 825-860 of E. coli 16S rRNA.
Claim 235
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 178 and a nucleic acid sequence substantially complementary thereto.
Claim 236
Dependent Claim
18 words
The probe of claim 31 wherein said non-viral organisms are the subgeneric grouping known as Group I Pseudomonas.
Claim 237
Dependent Claim
23 words
The probe of claim 180 wherein said oligonucleotide comprises the sequence CAG ACA AAG TTT CTC GTG CTC CGT CCT ACT CGA TT.
Claim 238
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 181 or to the complement thereof.
Claim 239
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence CAG ACA AAG TTT CTC GTG CTC CGT CCT ACT CGA TT and a nucleic acid substantially complementary thereto.
Claim 240
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence CAG ACA AAG TTT CTC GTG CTC CGT CCT ACT CGA TT and a nucleic acid substantially complementary thereto.
Claim 241
Dependent Claim
22 words
A nucleotide polymer of the structure CAG ACA AAG TTT CTC GTG CTC CGT CCT ACT CGA TT and the complement thereto.
Claim 242
Dependent Claim
22 words
A nucleotide polymer of the structure CAG ACA AAG TTT CTC GTG CTC CGT CCT ACT CGA TT and the complement thereto.
Claim 243
Dependent Claim
31 words
A nucleotide polymer capable of hybridizing to the RNA of the sub-generic grouping known as group I Pseudomonas in the region corresponding to the bases 365-405 of E. coli 23S rRNA.
Claim 244
Dependent Claim
31 words
A nucleotide polymer capable of hybridizing to the RNA of the sub-generic grouping known as group I Pseudomonas in the region corresponding to the bases 365-405 of E. coli 23S rRNA.
Claim 245
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 185 and a nucleic acid sequence substantially complementary thereto.
Claim 246
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Enterobacter cloacae .
Claim 247
Dependent Claim
21 words
The probe of claim 187 wherein said oligonucleotide comprises the sequence GTG TGT TTT CGT GTA CGG GAC TTT CAC CC.
Claim 248
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 188 or to the complement thereof.
Claim 249
Dependent Claim
38 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence GTG TGT TTT CGT GTA CGG GAC TTT CAC CC and a nucleic acid sequence substantially complementary thereto.
Claim 250
Dependent Claim
38 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence GTG TGT TTT CGT GTA CGG GAC TTT CAC CC and a nucleic acid sequence substantially complementary thereto.
Claim 251
Dependent Claim
20 words
A nucleotide polymer of the structure GTG TGT TTT CGT GTA CGG GAC TTT CAC CC and the complement thereto.
Claim 252
Dependent Claim
20 words
A nucleotide polymer of the structure GTG TGT TTT CGT GTA CGG GAC TTT CAC CC and the complement thereto.
Claim 253
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Enterobacter cloacae in the region corresponding to bases 305-340 of E. coli 23S rRNA.
Claim 254
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Enterobacter cloacae in the region corresponding to bases 305-340 of E. coli 23S rRNA.
Claim 255
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 192 and a nucleic acid sequence substantially complementary thereto.
Claim 256
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Proteus mirabilis .
Claim 257
Dependent Claim
22 words
The probe of claim 194 wherein said oligonucleotide comprises the sequence CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC.
Claim 258
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 195 or to the complement thereof.
Claim 259
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC and a nucleic acid sequence substantially complementary thereto.
Claim 260
Dependent Claim
30 words
A nucleic acid hybrid formed between an oligonucleotide comprising the sequence CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC and a nucleic acid sequence substantially complementary thereto.
Claim 261
Dependent Claim
23 words
A nucleotide polymer of the structure CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC and the complement thereto. complementary thereto.
Claim 262
Dependent Claim
23 words
A nucleotide polymer of the structure CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC and the complement thereto. complementary thereto.
Claim 263
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Proteus mirabilis in the region corresponding to bases 270-305 of E. coli 23S rRNA.
Claim 264
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the species Proteus mirabilis in the region corresponding to bases 270-305 of E. coli 23S rRNA.
Claim 265
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 199 and a nucleic acid sequence substantially complementary thereto.
Claim 266
Dependent Claim
14 words
The probe of claim 31 wherein said non-viral organisms are the genus Salmonella .
Claim 267
Dependent Claim
21 words
The probe of claim 201 wherein said oligonucleotide comprises the sequence CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC.
Claim 268
Dependent Claim
23 words
The probe of claim 201 wherein said oligonucleotide comprises the sequence CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A.
Claim 269
Dependent Claim
19 words
A nucleotide polymer capable of hybridizing to the probe of claim 202 or 203 or to the complement thereof.
Claim 270
Dependent Claim
51 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC and CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A; and a nucleic acid sequence substantially complementary thereto.
Claim 271
Dependent Claim
51 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC and CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A; and a nucleic acid sequence substantially complementary thereto.
Claim 272
Dependent Claim
43 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC and CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A; and the complements thereto.
Claim 273
Dependent Claim
43 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC and CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A; and the complements thereto.
Claim 274
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Salmonella in the region corresponding to bases 1125-1155 of E. coli 16S rRNA.
Claim 275
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Salmonella in the region corresponding to bases 1125-1155 of E. coli 16S rRNA.
Claim 276
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 207 and a nucleic acid sequence substantially complementary thereto.
Claim 277
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Salmonella in the region corresponding to bases 335-375 of E. coli 23S rRNA.
Claim 278
Dependent Claim
25 words
A nucleotide polymer capable of hybridizing to the RNA of the genus Salmonella in the region corresponding to bases 335-375 of E. coli 23S rRNA.
Claim 279
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 209 and a nucleic acid sequence substantially complementary thereto.
Claim 280
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Escherichia coli .
Claim 281
Dependent Claim
21 words
The probe of claim 211 wherein said oligonucleotide comprises the sequence GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG.
Claim 282
Dependent Claim
17 words
A nucleotide polymer capable of hybridizing to the probe of claim 212 or to the complement thereof.
Claim 283
Dependent Claim
28 words
A nucleic acid hybrid formed between an oligonu-cleotide comprising the sequence GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG and a nucleic acid substantially complementary thereto.
Claim 284
Dependent Claim
28 words
A nucleic acid hybrid formed between an oligonu-cleotide comprising the sequence GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG and a nucleic acid substantially complementary thereto.
Claim 285
Dependent Claim
20 words
A nucleotide polymer of the structure GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG and the complement thereto.
Claim 286
Dependent Claim
20 words
A nucleotide polymer of the structure GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG and the complement thereto.
Claim 287
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Escherichia coli on the region corresponding to bases 995-1030 of E . coli 16 sRNA.
Claim 288
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Escherichia coli on the region corresponding to bases 995-1030 of E . coli 16 sRNA.
Claim 289
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 216 and a nucleic acid sequence substantially complementary thereto.
Claim 290
Dependent Claim
14 words
The probe of claim 31 wherein said non-viral organisms are the phylogenetic group bacteria.
Claim 291
Dependent Claim
21 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC.
Claim 292
Dependent Claim
22 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG.
Claim 293
Dependent Claim
20 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence GCT CGT TGC GGG ACT TAA CCC AAC AT.
Claim 294
Dependent Claim
20 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence GGG GTT CTT TTC GCC TTT CCC TCA CGG.
Claim 295
Dependent Claim
19 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence GGC TGC TTC TAA GCC AAC ATC CTG.
Claim 296
Dependent Claim
19 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence GGA CCG TTA TAG TTA CGG CCG CC.
Claim 297
Dependent Claim
23 words
The probe of claim 218 wherein said oligonucleotide comprises the sequence GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C.
Claim 298
Dependent Claim
29 words
A nucleotide polymer capable of hybridizing to the probes of claim 219 or 220 or 221 or 222 or 223 or 224 or 225 or to the complement thereof.
Claim 299
Dependent Claim
96 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC, CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG, GCT CGT TGC GGG ACT TAA CCC AAC AT, GGG GTT CTT TTC GCC TTT CCC TCA CGG, GGC TGC TTC TAA GCC AAC ATC CTG, GGA CCG TTA TAG TTA CGG CCG CC, and GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C; and a nucleic acid sequence substantially similar thereto.
Claim 300
Dependent Claim
96 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC, CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG, GCT CGT TGC GGG ACT TAA CCC AAC AT, GGG GTT CTT TTC GCC TTT CCC TCA CGG, GGC TGC TTC TAA GCC AAC ATC CTG, GGA CCG TTA TAG TTA CGG CCG CC, and GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C; and a nucleic acid sequence substantially similar thereto.
Claim 301
Dependent Claim
88 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC, CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG, GCT CGT TGC GGG ACT TAA CCC AAC AT, GGG GTT CTT TTC GCC TTT CCC TCA CGG, GGC TGC TTC TAA GCC AAC ATC CTG, GGA CCG TTA TAG TTA CGG CCG CC, and GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C; and the complements thereto.
Claim 302
Dependent Claim
88 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC, CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG, GCT CGT TGC GGG ACT TAA CCC AAC AT, GGG GTT CTT TTC GCC TTT CCC TCA CGG, GGC TGC TTC TAA GCC AAC ATC CTG, GGA CCG TTA TAG TTA CGG CCG CC, and GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C; and the complements thereto.
Claim 303
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 330-365 of E. coli 16S rRNA.
Claim 304
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 330-365 of E. coli 16S rRNA.
Claim 305
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 229 and a nucleic acid sequence substantially complementary thereto.
Claim 306
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 675-715 of E. coli 16S rRNA.
Claim 307
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 675-715 of E. coli 16S rRNA.
Claim 308
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 231 and a nucleic acid sequence substantially complementary thereto.
Claim 309
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1080-1110 of E. coli 16S rRNA.
Claim 310
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1080-1110 of E. coli 16S rRNA.
Claim 311
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 233 and a nucleic acid sequence substantially complementary thereto.
Claim 312
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 460-490 of E. coli 23S rRNA.
Claim 313
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 460-490 of E. coli 23S rRNA.
Claim 314
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 235 and a nucleic acid sequence substantially complementary thereto.
Claim 315
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1050-1080 of E. coli 23S rRNA.
Claim 316
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1050-1080 of E. coli 23S rRNA.
Claim 317
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 237 and a nucleic acid sequence substantially complementary thereto.
Claim 318
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1900-1960 of E. coli 23S rRNA.
Claim 319
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group bacteria in the region corresponding to bases 1900-1960 of E. coli 23S rRNA.
Claim 320
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 239 and a nucleic acid sequence substantially complementary thereto.
Claim 321
Dependent Claim
11 words
The probe of claim 31 wherein said non-viral organisms are fungi.
Claim 322
Dependent Claim
21 words
The probe of claim 241 wherein said oligonucleotide comprises the sequence CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG.
Claim 323
Dependent Claim
12 words
The probe of claim 241 wherein said oligonucleotide comprise the sequence CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC.
Claim 324
Dependent Claim
12 words
The probe of claim 241 wherein said oligonucleotide comprises the sequence CCCGACCGTCCCTATTAATCATTACGATGG.
Claim 325
Dependent Claim
22 words
The probe of claim 241 wherein said oligonucleotide comprises the sequence CGA CTT GGC ATG AAA ACT ATT CCT TCC TGT GG.
Claim 326
Dependent Claim
25 words
The probe of claim 241 wherein said oligonucleotide comprises the sequence GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGC AAC AAG G.
Claim 327
Dependent Claim
25 words
The probe of claim 241 wherein said oligonucleotide comprises the sequence GCT CTG CAT TCA AAG GTC CGC GTT CAA TAA AGA AAC AGG G.
Claim 328
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the probe of claims 242 or 243 or 244 or 245 or 246 or 247 or to the complement thereof.
Claim 329
Dependent Claim
80 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG, CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC CCCGACCGTCCCTATTAATCATTACGATGG CGA CTT GGC ATG AAA ACT ATT CCT TCC TAT GG, GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGC AAC AGG G, and GCT CTG CAT TCA AAC GTC CGC GTT CAA TAA AGA AAC AGG G; and a nucleic acid sequence substantially complementary thereto.
Claim 330
Dependent Claim
80 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequence CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG, CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC CCCGACCGTCCCTATTAATCATTACGATGG CGA CTT GGC ATG AAA ACT ATT CCT TCC TAT GG, GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGC AAC AGG G, and GCT CTG CAT TCA AAC GTC CGC GTT CAA TAA AGA AAC AGG G; and a nucleic acid sequence substantially complementary thereto.
Claim 331
Dependent Claim
72 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG, CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC CCCGACCGTCCCTATTAATCATTACGATGG CGA CTT GGC ATG AAA ACT ATT CCT TCC TAT GG, GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGC AAC AGG G, and GCT CTG CAT TCA AAC GTC CGC GTT CAA TAA AGA AAC AGG G; and the complements thereto.
Claim 332
Dependent Claim
72 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG, CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC CCCGACCGTCCCTATTAATCATTACGATGG CGA CTT GGC ATG AAA ACT ATT CCT TCC TAT GG, GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGC AAC AGG G, and GCT CTG CAT TCA AAC GTC CGC GTT CAA TAA AGA AAC AGG G; and the complements thereto.
Claim 333
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 845-880 of Saccharomyces cerevisiae 18S rRNA.
Claim 334
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 845-880 of Saccharomyces cerevisiae 18S rRNA.
Claim 335
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 251 and a nucleic acid sequence substantially complementary thereto.
Claim 336
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 1960-2000 of Saccharomyces cerevisiae 28S rRNA.
Claim 337
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 1960-2000 of Saccharomyces cerevisiae 28S rRNA.
Claim 338
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 253 and a nucleic acid substantially complementary thereto.
Claim 339
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 1225-1270 of Saccharomyces cerevisiae 28S rRNA.
Claim 340
Dependent Claim
26 words
A nucleotide polymer capable of hybridizing to the RNA of the phylogenetic group Fungi in the region corresponding to position 1225-1270 of Saccharomyces cerevisiae 28S rRNA.
Claim 341
Dependent Claim
19 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 255 and a nucleic acid substantially complementary thereto.
Claim 342
Dependent Claim
13 words
The probe of claim 31 wherein said non-viral organism is Neisseria gonorrhoeae .
Claim 343
Dependent Claim
17 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence CCG CCG CTA CCC GGT AC.
Claim 344
Dependent Claim
18 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence TCA TCG GCC GCC GAT ATT GGC.
Claim 345
Dependent Claim
21 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence GAG CAT TCC GCA CAT GTC AAA ACC AGG TA.
Claim 346
Dependent Claim
20 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence GAG GAT TCC GCA CAT GTC AAA ACC AGG.
Claim 347
Dependent Claim
21 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence GAG GAT TCC GCA CAT GTC AAA ACC AGG TAA.
Claim 348
Dependent Claim
17 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence CCC GCT ACC CGG TAC GTTC.
Claim 349
Dependent Claim
16 words
The probe of claim 257 wherein said oligonucleotide comprises the sequence CCG CTA CCC GGTAC GTTC.
Claim 350
Dependent Claim
29 words
A nucleotide polymer capable of hybridizing to the probe of claims 258 or 259 or 260 or 261 or 262 or 263 or 264 or to the complement thereof.
Claim 351
Dependent Claim
36 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences CCGCCGCTACCCGGTAC, TCATCGGCCGCCGATATTGGC, GAGCATTCCGCACATGTCAAAACCAGGTA, GAGGATTCCGCACATGTCAAAACCAGG, GAGGATTCCGCACATGTCAAAACCAGGTAA, CCCGCTACCCGGTACGTTC, and CCGCTACCCGGTACGTTC; and a nucleic acid sequence substantially complementary thereto.
Claim 352
Dependent Claim
36 words
A nucleic acid hybrid formed between an oligonucleotide comprising a member of the group consisting of oligonucleotides of the sequences CCGCCGCTACCCGGTAC, TCATCGGCCGCCGATATTGGC, GAGCATTCCGCACATGTCAAAACCAGGTA, GAGGATTCCGCACATGTCAAAACCAGG, GAGGATTCCGCACATGTCAAAACCAGGTAA, CCCGCTACCCGGTACGTTC, and CCGCTACCCGGTACGTTC; and a nucleic acid sequence substantially complementary thereto.
Claim 353
Dependent Claim
28 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCGCCGCTACCCGGTAC, TCATCGGCCGCCGATATTGGC, GAGCATTCCGCACATGTCAAAACCAGGTA, GAGGATTCCGCACATGTCAAAACCAGG, GAGGATTCCGCACATGTCAAAACCAGGTAA, CCCGCTACCCGGTACGTTC, and CCGCTACCCGGTACGTTC; and the complements thereto.
Claim 354
Dependent Claim
28 words
A nucleotide polymer comprising a member of the group consisting of nucleotide polymers of the structures CCGCCGCTACCCGGTAC, TCATCGGCCGCCGATATTGGC, GAGCATTCCGCACATGTCAAAACCAGGTA, GAGGATTCCGCACATGTCAAAACCAGG, GAGGATTCCGCACATGTCAAAACCAGGTAA, CCCGCTACCCGGTACGTTC, and CCGCTACCCGGTACGTTC; and the complements thereto.
Claim 355
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 125-150 of E . coli 16s rRNA.
Claim 356
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 125-150 of E . coli 16s rRNA.
Claim 357
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 268 and a nucleic acid sequence substantially complementary thereto.
Claim 358
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 455-485 of E . coli 16s rRNA.
Claim 359
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 455-485 of E . coli 16s rRNA.
Claim 360
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 270 and a nucleic acid sequence substantially complementary thereto.
Claim 361
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 980-1015 of E . coli 16s rRNA.
Claim 362
Dependent Claim
27 words
A nucleotide polymer capable of hybridizing to the RNA of the species Neisseria gonorrhoeae in the region correspon-ding to bases 980-1015 of E . coli 16s rRNA.
Claim 363
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 272 and a nucleic acid sequence substantially complementary thereto.
Claim 364
Dependent Claim
16 words
The probe of claim 31 wherein said oligonucleotide is perfectly complementary to said region of rRNA.
Claim 365
Dependent Claim
18 words
The probe of claim 31 wherein said oligonucleotide is about 20 nucleotides to about 50 nucleotides in length.
Claim 366
Dependent Claim
19 words
The probe of claim 31 wherein said oligonucleotide is at least about 95% complementary to a region of rRNA.
Claim 367
Dependent Claim
81 words
A hybridization assay comprising (1) reacting together any rRNA from a sample to be assayed for a non-viral organism or organisms and an oligonucleotide probe of at least about 10 nucleotides in length which is at least about 75% complementary to a variable region of rRNA selected to be unique to said non-viral organism or organisms, (2) under conditions such that hybridization between the oligonucleotide probe and any sufficiently complementary sample rRNA can occur, and (3) observing and/or measuring said hybridization.
Claim 368
Dependent Claim
81 words
A hybridization assay comprising (1) reacting together any rRNA from a sample to be assayed for a non-viral organism or organisms and an oligonucleotide probe of at least about 10 nucleotides in length which is at least about 75% complementary to a variable region of rRNA selected to be unique to said non-viral organism or organisms, (2) under conditions such that hybridization between the oligonucleotide probe and any sufficiently complementary sample rRNA can occur, and (3) observing and/or measuring said hybridization.
Claim 369
Dependent Claim
26 words
The assay of claim 277 wherein said hybridization between the oligonucleotide probe and any target sample rRNA is from at least about 10% to about 100%.
Claim 370
Dependent Claim
11 words
The assay of claim 277 wherein said oligonucleotide probe is cDNA.
Claim 371
Dependent Claim
21 words
The assay of claim 277 wherein said conditions include a temperature from about 25°C below Tm to about 1°C below Tm.
Claim 372
Dependent Claim
23 words
The assay of claim 277 which further comprises the parallel assay of a positive homologous control, or a positive heterologous control, or both.
Claim 373
Dependent Claim
15 words
The assay of claim 277 which further comprises the parallel assay of a negative control.
Claim 374
Dependent Claim
15 words
The assay of claim 277 wherein said conditions include agents for increased rates of hybridization.
Claim 375
Dependent Claim
36 words
The assay of claim 277 wherein said conditions are such as to promote maximum hybridization between the oligonucleotide probe and any complementary sample rRNA and minimum cross-reactivity between the oligonucleotide probe and any non-complementary sample rRNA.
Claim 376
Dependent Claim
11 words
The assay of claim 277 wherein said oligonucleotide probe is labelled.
Claim 377
Dependent Claim
18 words
The assay of claim 285 wherein said oligonucleotide probe is labelled with an isotopic, non-isotopic or chemiluminescent label.
Claim 378
Dependent Claim
27 words
The assay of claim 277 which further comprises the release of rRNA from the cells of said non-viral organism or organisms prior to the reacting together step.
Claim 379
Dependent Claim
57 words
The assay of claim 277 wherein said non-viral organism or organisms are Mycobacterium avium , Mycobacterium intracellulare , the Mycobacterium tuberculosis -complex bacteria, Mycobacterium genus, Mycoplasma pneumoniae , Legionella , Salmonella , Chlamydia trachomatis , Campylobacter , Proteus mirabilis , Entero coccus , Enterobacter cloacae , E . coli , Pseudomonas group I , bacteria or fungi.
Claim 380
Dependent Claim
20 words
The assay of claim 277 wherein said labelled oligonucleotide probe is about 20 nucleotides to about 50 nucleotides in length.
Claim 381
Dependent Claim
22 words
The assay of claim 277 wherein said labelled oligonucleotide probe is at least about 95% complementary to said variable region of rRNA.
Claim 382
Dependent Claim
49 words
The assay of claim 277 further comprising the use of one or more additional oligonucleotide probes of at least about 10 nucleotides in length and which are at least about 75% complementary to one or more additional variable regions of rRNA selected to be unique to said non-viral organisms.
Claim 383
Dependent Claim
33 words
The assay of claim 277 further comprising the use of one or more additional probes which identify one or more additional non-viral organisms, thereby expanding the group of non-viral organisms to be assayed.
Claim 384
Independent Claim
217 words
A method for preparing a probe or combination of probes for use in a qualitative or quantitative hybridization assay which comprises constructing a nucleotide polymer that is sufficiently complementary to hybridize a region of DNA or rRNA selected to distinguish a target non-viral organism or group of non-viral organisms sought to be detected from at least one nontarget organism or group or nontarget organisms which may be present in a sample, said region of DNA or rRNA being selected by: comparing one or more DNA or rRNA sequences of said non-viral organism or group of non-viral organisms sought to be detected with one or more DNA or rRNA sequences of said nontarget organisms or group of nontarget organisms; aligning said DNA or rRNA sequences of said non-viral organism or group of non-viral organisms to homologies with said DNA or rRNA sequences of said nontarget organisms or group of organisms so as to identify regions of homology; selecting said nucleotide polymer by substantially maximizing the homology of said probe oligonucleotide to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected while substantially minimizing the homology of said nucleotide polymer to DNA or rRNA sequences of said nontarget organisms or group of organisms sought to be distinguished therefrom.
Claim 385
Independent Claim
217 words
A method for preparing a probe or combination of probes for use in a qualitative or quantitative hybridization assay which comprises constructing a nucleotide polymer that is sufficiently complementary to hybridize a region of DNA or rRNA selected to distinguish a target non-viral organism or group of non-viral organisms sought to be detected from at least one nontarget organism or group or nontarget organisms which may be present in a sample, said region of DNA or rRNA being selected by: comparing one or more DNA or rRNA sequences of said non-viral organism or group of non-viral organisms sought to be detected with one or more DNA or rRNA sequences of said nontarget organisms or group of nontarget organisms; aligning said DNA or rRNA sequences of said non-viral organism or group of non-viral organisms to homologies with said DNA or rRNA sequences of said nontarget organisms or group of organisms so as to identify regions of homology; selecting said nucleotide polymer by substantially maximizing the homology of said probe oligonucleotide to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected while substantially minimizing the homology of said nucleotide polymer to DNA or rRNA sequences of said nontarget organisms or group of organisms sought to be distinguished therefrom.
Claim 386
Dependent Claim
26 words
A method as in claim 293 wherein said nontarget organisms or group of organisms are close phylogenetic relatives of said target organisms or group of organisms.
Claim 387
Dependent Claim
36 words
The method of claim 292 wherein said nucleotide polymer is at least about 90% homologous to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected.
Claim 388
Dependent Claim
30 words
The method of claim 292 wherein said probe oligonucleotide is less than about 90% homologous to DNA or rRNA sequences of said closest phylogenetic relatives sought to be distinguished therefrom.
Claim 389
Dependent Claim
41 words
The method of claim 293 or 294 or 295 or 296 comprising the further step of verifying said probe non-cross reactivity by hybridizing said probe oligonucleotide to non-viral organisms or groups of non-viral organisms sought to be distinguished by said probe.
Claim 390
Independent Claim
194 words
A method for preparing a probe for use in a qualitative or quantitative hybridization assay which comprises constructing an oligonucleotide that is sufficiently complementary to hybridize a region of DNA or rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of DNA or rRNA being selected by: comparing one or more DNA or rRNA sequences of said non-viral organism or group of non-viral organisms sought to be detected with one or more DNA or rRNA sequences of its closest phylogenetic relatives; aligning said DNA or rRNA sequences of said non-viral organism or group of non-viral organisms to homologies with said DNA or rRNA sequences of said closest phylogenetic relatives, so as to reveal the interspecies hypervariable DNA or rRNA regions; selecting said probe oligonucleotide in said interspecies hypervariable region by substantially maximizing the homology of said probe oligonucleotide to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected while substantially minimizing the homology of said probe oligonucleotide to DNA or rRNA sequences of said closest phylogenetic relatives sought to be distinguished therefrom.
Claim 391
Independent Claim
194 words
A method for preparing a probe for use in a qualitative or quantitative hybridization assay which comprises constructing an oligonucleotide that is sufficiently complementary to hybridize a region of DNA or rRNA selected to be unique to a non-viral organism or group of non-viral organisms sought to be detected, said region of DNA or rRNA being selected by: comparing one or more DNA or rRNA sequences of said non-viral organism or group of non-viral organisms sought to be detected with one or more DNA or rRNA sequences of its closest phylogenetic relatives; aligning said DNA or rRNA sequences of said non-viral organism or group of non-viral organisms to homologies with said DNA or rRNA sequences of said closest phylogenetic relatives, so as to reveal the interspecies hypervariable DNA or rRNA regions; selecting said probe oligonucleotide in said interspecies hypervariable region by substantially maximizing the homology of said probe oligonucleotide to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected while substantially minimizing the homology of said probe oligonucleotide to DNA or rRNA sequences of said closest phylogenetic relatives sought to be distinguished therefrom.
Claim 392
Dependent Claim
36 words
The method of claim 298 wherein said probe oligonucleotide is at least about 90% homologous to the regions of said DNA or rRNA of said non-viral organism or non-viral group of organisms sought to be detected.
Claim 393
Dependent Claim
30 words
The method of claim 298 wherein said probe oligonucleotide is less than about 90% homologous to DNA or rRNA sequences of said closest phylogenetic relatives sought to be distinguished therefrom.
Claim 394
Dependent Claim
39 words
The method of claim 298 or 299 or 300 comprising the further step of verifying said probe non-cross reactivity by hybridizing said probe oligonucleotide to non-viral organisms or groups of non-viral organisms sought to be distringuished by said probe.
Claim 395
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 60-100 of E.Coli 16S rRNA.
Claim 396
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 60-100 of E.Coli 16S rRNA.
Claim 397
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 302 and a nucleic acid sequence substantially complementary thereto.
Claim 398
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 120-150 of E.Coli 16S rRNA.
Claim 399
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 120-150 of E.Coli 16S rRNA.
Claim 400
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 304 and a nucleic acid sequence substantially complementary thereto.
Claim 401
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 170-230 of E.Coli 16S rRNA.
Claim 402
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 170-230 of E.Coli 16S rRNA.
Claim 403
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 306 and a nucleic acid sequence substantially complementary thereto.
Claim 404
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 405-480 of E.Coli 16S rRNA.
Claim 405
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 405-480 of E.Coli 16S rRNA.
Claim 406
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 308 and a nucleic acid sequence substantially complementary thereto.
Claim 407
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 600-670 of E.Coli 16S rRNA.
Claim 408
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 600-670 of E.Coli 16S rRNA.
Claim 409
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 310 and a nucleic acid sequence substantially complementary thereto.
Claim 410
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 820-860 of E.Coli 16S rRNA.
Claim 411
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 820-860 of E.Coli 16S rRNA.
Claim 412
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 312 and a nucleic acid sequence substantially complementary thereto.
Claim 413
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 980-1050 of E.Coli 16S rRNA.
Claim 414
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 980-1050 of E.Coli 16S rRNA.
Claim 415
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 314 and a nucleic acid sequence substantially complementary thereto.
Claim 416
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1250-1290 of E.Coli 16S rRNA.
Claim 417
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 16S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1250-1290 of E.Coli 16S rRNA.
Claim 418
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 316 and a nucleic acid sequence substantially complementary thereto.
Claim 419
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 270-390 of E.Coli 23S rRNA.
Claim 420
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 270-390 of E.Coli 23S rRNA.
Claim 421
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 318 and a nucleic acid sequence substantially complementary thereto.
Claim 422
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 535-560 of E.Coli 23S rRNA.
Claim 423
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 535-560 of E.Coli 23S rRNA.
Claim 424
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 320 and a nucleic acid sequence substantially complementary thereto.
Claim 425
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1150-1200 of E.Coli 23S rRNA.
Claim 426
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1150-1200 of E.Coli 23S rRNA.
Claim 427
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 322 and a nucleic acid sequence substantially complementary thereto.
Claim 428
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1440-1600 of E.Coli 23S rRNA.
Claim 429
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1440-1600 of E.Coli 23S rRNA.
Claim 430
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 324 and a nucleic acid sequence substantially complementary thereto.
Claim 431
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1710-1750 of E.Coli 23S rRNA.
Claim 432
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 1710-1750 of E.Coli 23S rRNA.
Claim 433
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 326 and a nucleic acid sequence substantially complementary thereto.
Claim 434
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 2190-2330 of E.Coli 23S rRNA.
Claim 435
Dependent Claim
35 words
A probe consisting of a nucleotide polymer which is capable of hybridizing to 23S like rRNA of a nonviral organism or group of organisms in the region corresponding to bases 2190-2330 of E.Coli 23S rRNA.
Claim 436
Dependent Claim
20 words
A nucleic acid hybrid formed between a nucleotide polymer of claim 328 and a nucleic acid sequence substantially complementary thereto.
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
Maintenance schedule is calculated for granted US utility patents.