Patent EP0335633A2 successfully refreshed from Google Patents.
EP0335633A2
Expired / Lapsed
EP
⏱️ 0.0 years remaining
Detecting Eukaryotic Microorganisms
Assignee: BP Corp North America Inc
•
Filing: 1989-03-28
•
Granted: —
•
Expires: 2009-03-28
Abstract
Abstract A cDNA probe, for use in detecting in a sample, under conditions of predetermined stringency, a target organism belonging to a strain of fungal microorganisms, and not detecting in the sample under such conditions a reference microorganism or any prokaryotic microorganism, can be constructed by: determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from the target organism, the variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and having no corresponding region in prokaryotes; comparing the nucleotide base region in the variable region from the target organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from the reference microorganism, and selecting as a useful probe site a subsequence within the determined sequence; and synthesizing a cDNA complementary to the useful probe site, the cDNA being the probe.
Inventors
- 👤 Jeffrey F. Lemontt
Bibliographic Details
Application Number
—
Jurisdiction
EP
Data Source
google_patents
Last Synchronized
2026-10-29 10:36
CPC Classifications
C; C12; C12Q; C12Q1/00; C12Q1/68; C12Q1/6876; C12Q1/6888; C12Q1/6895; Y; Y10; Y10S; Y10S435/00; Y10S435/81; Y10S435/8215; Y10S435/911; Y10S435/921; Y10S435/922; Y10S435/924
Claims Analysis
Total Claims: 19
Claim 1
Independent Claim
160 words
A method for contructing a cDNA probe for use in detecting in a sample under conditions of predetermined stringency a target organism belonging to a strain of fungal microorganisms and not detecting in said sample under said conditions a reference microorganism, said probe not detecting in said sample under said conditions any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from said target organism, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said target organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said reference microorganism, and selecting as a useful probe site a subsequence within said determined sequence, and (3) synthesizing a cDNA complementary to said useful probe site, said cDNA being said probe.
Claim 2
Independent Claim
160 words
A method for contructing a cDNA probe for use in detecting in a sample under conditions of predetermined stringency a target organism belonging to a strain of fungal microorganisms and not detecting in said sample under said conditions a reference microorganism, said probe not detecting in said sample under said conditions any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from said target organism, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said target organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said reference microorganism, and selecting as a useful probe site a subsequence within said determined sequence, and (3) synthesizing a cDNA complementary to said useful probe site, said cDNA being said probe.
Claim 3
Independent Claim
417 words
A method for contructing a cDNA probe for use in detecting in a sample a target organism belonging to a strain of fungal microorganisms and not detecting any of a plurality of reference microorganisms, said probe not detecting any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from said target organism, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and said variable region having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said target organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from one of said reference microorganisms, and selecting as a potential probe site a subsequence within said determined sequence, (3) synthesizing a cDNA complementary to said useful probe site, (4) contacting said cDNA with RNA from said reference microorganisms under conditions that allow said cDNA to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (5) determining whether hybrid nucleic acid complexes are formed during said contacting, and (6) if hybrid nucleic acid complexes are not formed during said contacting, then said cDNA is said probe; but (7) if hybrid nucleic acid complexes are formed during said contacting, then (a) determining a nucleotide base sequence in said variable region of small subunit ribosomal RNA from a next one of said reference organisms, (b) comparing said nucleotide base region in said variable region from said next reference organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said first reference microorganism and with the corresponding region of small subunit ribosomal RNA from said target microorganism and selecting as a potential next refined probe site a subsequence within said determined sequence, (c) synthesizing a cDNA complementary to said next refined probe site, (d) contacting said cDNA complementary to said next refined probe site with RNA from said reference microorganisms under conditions that allow said cDNA complementary to said next refined probe site to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (e) determining whether hybrid nucleic acid complexes are formed during said contacting, and (f) if hybrid nucleic acid complexes are not formed during said contacting, then said cDNA complementary to said next refined probe site is said probe; but (g) if hybrid nucleic acid complexes are not formed during said contacting, then (h) repeating steps (a) through (g).
Claim 4
Independent Claim
417 words
A method for contructing a cDNA probe for use in detecting in a sample a target organism belonging to a strain of fungal microorganisms and not detecting any of a plurality of reference microorganisms, said probe not detecting any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from said target organism, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and said variable region having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said target organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from one of said reference microorganisms, and selecting as a potential probe site a subsequence within said determined sequence, (3) synthesizing a cDNA complementary to said useful probe site, (4) contacting said cDNA with RNA from said reference microorganisms under conditions that allow said cDNA to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (5) determining whether hybrid nucleic acid complexes are formed during said contacting, and (6) if hybrid nucleic acid complexes are not formed during said contacting, then said cDNA is said probe; but (7) if hybrid nucleic acid complexes are formed during said contacting, then (a) determining a nucleotide base sequence in said variable region of small subunit ribosomal RNA from a next one of said reference organisms, (b) comparing said nucleotide base region in said variable region from said next reference organism with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said first reference microorganism and with the corresponding region of small subunit ribosomal RNA from said target microorganism and selecting as a potential next refined probe site a subsequence within said determined sequence, (c) synthesizing a cDNA complementary to said next refined probe site, (d) contacting said cDNA complementary to said next refined probe site with RNA from said reference microorganisms under conditions that allow said cDNA complementary to said next refined probe site to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (e) determining whether hybrid nucleic acid complexes are formed during said contacting, and (f) if hybrid nucleic acid complexes are not formed during said contacting, then said cDNA complementary to said next refined probe site is said probe; but (g) if hybrid nucleic acid complexes are not formed during said contacting, then (h) repeating steps (a) through (g).
Claim 5
Independent Claim
590 words
A method for contructing a cDNA probe for use in detecting in a sample a target organism belonging to any of a plurality of predetermined strains of fungal microorganisms and not detecting any of a plurality of reference microorganisms, said probe not detecting any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from a first one of said predetermined strains of fungal microorganisms, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and said variable region having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said first strain with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from one of said reference microorganisms, and selecting as a potential probe site a subsequence within said determined sequence, (3) synthesizing a cDNA complementary to said useful probe site, (4) contacting said cDNA with RNA from said fungal microorganisms and with RNA from said reference microorganisms under conditions that allow said cDNA to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (5) determining whether hybrid nucleic acid complexes are formed with RNA from said predetermined strain of fungal microorganisms during said contacting and determining whether hybrid nucleic acid complexes are formed with RNA from said reference microorganisms during said contacting, and (6) if hybrid nucleic acid complexes are formed with RNA from each of said predetermined strains during said contacting and are not formed with RNA from any of said reference microorganisms during said contacting, then said cDNA is said probe; but (7) if hybrid nucleic acid complexes are not formed with RNA from any of said reference microorganisms and if hybrid nucleic acid complexes are not formed with RNA from one or more of said predetermined strains during said contacting, then (a) determining a nucleotide base sequence in said variable region of small subunit ribosomal RNA from a next one of said predetermined strains, (b) comparing said nucleotide base region in said variable region from said next predetermined strain with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said first predetermined strain and the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said one of said reference microorganisms, and selecting as a potential next refined probe site a subsequence within said determined sequence, (c) synthesizing a cDNA complementary to said next refined probe site, (d) contacting said cDNA complementary to said next refined probe site with RNA from said fungal microorganisms and with RNA from said reference microorganisms under conditions that allow said cDNA complementary to said next refined probe site to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, e) determining whether hybrid nucleic acid complexes are formed with RNA from said fungal microorganisms during said contacting and determining whether hybrid nucleic acid complexes are formed with RNA from said reference microorganisms during said contacting, and (f) if hybrid nucleic acid complexes are formed with RNA from each of said predetermined strains and are not formed with RNA from any of said reference microorganisms during said contacting, then said cDNA is said probe; but (g) if hybrid nucleic acid complexes are not formed with RNA from any of said reference microorganisms and if hybrid nucleic acid complexes are not formed with RNA from one or more of said predetermined strains during said contacting then (h) repeating steps (a) through (g).
Claim 6
Independent Claim
590 words
A method for contructing a cDNA probe for use in detecting in a sample a target organism belonging to any of a plurality of predetermined strains of fungal microorganisms and not detecting any of a plurality of reference microorganisms, said probe not detecting any prokaryotic microorganism, comprising (1) determining a nucleotide base sequence in a variable region of small subunit ribosomal RNA from a first one of said predetermined strains of fungal microorganisms, said variable region being a region of the small subunit ribosomal RNA that is poorly conserved among eukaryotes and said variable region having no corresponding region in prokaryotes, (2) comparing said nucleotide base region in said variable region from said first strain with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from one of said reference microorganisms, and selecting as a potential probe site a subsequence within said determined sequence, (3) synthesizing a cDNA complementary to said useful probe site, (4) contacting said cDNA with RNA from said fungal microorganisms and with RNA from said reference microorganisms under conditions that allow said cDNA to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, (5) determining whether hybrid nucleic acid complexes are formed with RNA from said predetermined strain of fungal microorganisms during said contacting and determining whether hybrid nucleic acid complexes are formed with RNA from said reference microorganisms during said contacting, and (6) if hybrid nucleic acid complexes are formed with RNA from each of said predetermined strains during said contacting and are not formed with RNA from any of said reference microorganisms during said contacting, then said cDNA is said probe; but (7) if hybrid nucleic acid complexes are not formed with RNA from any of said reference microorganisms and if hybrid nucleic acid complexes are not formed with RNA from one or more of said predetermined strains during said contacting, then (a) determining a nucleotide base sequence in said variable region of small subunit ribosomal RNA from a next one of said predetermined strains, (b) comparing said nucleotide base region in said variable region from said next predetermined strain with the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said first predetermined strain and the nucleotide base sequence in the corresponding region of small subunit ribosomal RNA from said one of said reference microorganisms, and selecting as a potential next refined probe site a subsequence within said determined sequence, (c) synthesizing a cDNA complementary to said next refined probe site, (d) contacting said cDNA complementary to said next refined probe site with RNA from said fungal microorganisms and with RNA from said reference microorganisms under conditions that allow said cDNA complementary to said next refined probe site to hybridize with small subunit ribosomal RNA to form hybrid nucleic acid complexes, e) determining whether hybrid nucleic acid complexes are formed with RNA from said fungal microorganisms during said contacting and determining whether hybrid nucleic acid complexes are formed with RNA from said reference microorganisms during said contacting, and (f) if hybrid nucleic acid complexes are formed with RNA from each of said predetermined strains and are not formed with RNA from any of said reference microorganisms during said contacting, then said cDNA is said probe; but (g) if hybrid nucleic acid complexes are not formed with RNA from any of said reference microorganisms and if hybrid nucleic acid complexes are not formed with RNA from one or more of said predetermined strains during said contacting then (h) repeating steps (a) through (g).
Claim 7
Dependent Claim
27 words
A method as claimed in claim 1, 2 or 3 wherein said variable region corresponds to the variable region adjacent the 3′ end of universal helix 19.
Claim 8
Dependent Claim
19 words
A method as claimed in claim 1, 2 or 3 wherein said variable region corresponds to the 642-805 region.
Claim 9
Dependent Claim
158 words
A nucleic acid probe that detects, under conditions of predetermined stringency, the presence in a sample of a first predetermined strain of fungal microorganism and fails to detect, under said conditions, the presence in said sample both of a second predetermined strain of fungal microorganism and of any prokaryotic organism, said probe comprising a nucleic-acid sequence capable of hybridizing, under said conditions, with a subsequence of nucleotide bases comprising a portion of a nucleotide base sequence of said first predetermined strain, said nucleic acid sequence failing to hybridize, under said conditions, with a second subsequence of nucleotide bases comprising a corresponding portion of a nucleotide base sequence of said second predetermined strain, said nucleotide base sequence of said first predetermined strain and said corresponding nucleotide base sequence from said second predetermined second strain each corresponding to a variable region that is present in eukaryotic small subunit ribosomal RNA and is not present in prokaryotic small subunit ribosomal RNA.
Claim 10
Dependent Claim
158 words
A nucleic acid probe that detects, under conditions of predetermined stringency, the presence in a sample of a first predetermined strain of fungal microorganism and fails to detect, under said conditions, the presence in said sample both of a second predetermined strain of fungal microorganism and of any prokaryotic organism, said probe comprising a nucleic-acid sequence capable of hybridizing, under said conditions, with a subsequence of nucleotide bases comprising a portion of a nucleotide base sequence of said first predetermined strain, said nucleic acid sequence failing to hybridize, under said conditions, with a second subsequence of nucleotide bases comprising a corresponding portion of a nucleotide base sequence of said second predetermined strain, said nucleotide base sequence of said first predetermined strain and said corresponding nucleotide base sequence from said second predetermined second strain each corresponding to a variable region that is present in eukaryotic small subunit ribosomal RNA and is not present in prokaryotic small subunit ribosomal RNA.
Claim 11
Dependent Claim
24 words
A probe as claimed in claim 6, wherein said first predetermined strain is a strain of yeast, for example which is pathogenic to humans.
Claim 12
Dependent Claim
22 words
A probe as claimed in claim 6, wherein said first predetermined strain is a strain of Candida , preferably Candida albicans .
Claim 13
Dependent Claim
30 words
A probe as claimed in claim 6 wherein said first predetermined strain is Candida albicans ATCC strain 18804, and said second predetermined strain is a strain of Saccharomyces cerevisiae .
Claim 14
Dependent Claim
26 words
A probe as claimed in any one of claims 6 to 9, wherein said variable region is immediately adjacent the 3′ end of universal helix 19.
Claim 15
Dependent Claim
20 words
A probe as claimed in any one of claims 6 to 9, wherein said variable region is the 642-805 region.
Claim 16
Dependent Claim
39 words
A nucleic acid probe capable of detecting in a sample, under predetermined stringency conditions, Candida albicans , said probe comprising a nucleotide base sequence of at least about 15 consecutive nucleotides selected from the sequence 5′ GGAAAGGCTCGGCTGGGTCCAGTACGCATCAAAAAGATGGACC 3′ .
Claim 17
Dependent Claim
39 words
A nucleic acid probe capable of detecting in a sample, under predetermined stringency conditions, Candida albicans , said probe comprising a nucleotide base sequence of at least about 15 consecutive nucleotides selected from the sequence 5′ GGAAAGGCTCGGCTGGGTCCAGTACGCATCAAAAAGATGGACC 3′ .
Claim 18
Independent Claim
78 words
A method for detecting in a sample an organism belonging to a strain of eukaryotic microorganisms, comprising providing a probe as claimed in any one of claims 6 to 12, deriving RNA from said sample, contacting said probe with said RNA under conditions that allow said probe to hybridize with small subunit rRNA to form hybrid nucleic acid complexes, and detecting said hybrid nucleic acid complexes as an indication of the presence in said sample of said organism.
Claim 19
Dependent Claim
20 words
A kit, comprising a probe as claimed in any one of claims 6 to 12 and instructions for its use.
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
Maintenance schedule is calculated for granted US utility patents.