Patent US5352579A successfully refreshed from Google Patents.
US5352579A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Nucleic acid probes to histoplasma capsulatum
Assignee: Gen Probe Inc
•
Filing: 1991-06-28
•
Granted: 1994-10-04
•
Expires: 2011-06-28
Abstract
Abstract This invention discloses hybridization assay probes specific for Histoplasma capsulatum and no other fungi.
Inventors
- 👤 Curt L. Milliman
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-10-29 19:53
CPC Classifications
C; C12; C12Q; C12Q1/00; C12Q1/68; C12Q1/6876; C12Q1/6888; C12Q1/6895
Claims Analysis
Total Claims: 21
Claim 1
Independent Claim
34 words
A nucleic acid hybridization assay probe having sufficient complementarity to the rRNA or rDNA sequences of Histoplasma capsulatum, or to sequences complementary thereto, able to distinguish, under hybridization conditions, Histoplasma capsulatum from Blastomyces dermatitidis.
Claim 2
Dependent Claim
34 words
A nucleic acid hybridization assay probe having sufficient complementarity to the rRNA or rDNA sequences of Histoplasma capsulatum, or to sequences complementary thereto, able to distinguish, under hybridization conditions, Histoplasma capsulatum from Blastomyces dermatitidis.
Claim 3
Dependent Claim
14 words
The probe of claim 1, wherein said probe is complementary to rRNA or rDNA.
Claim 4
Dependent Claim
23 words
The probe of claim 1 or 2, wherein said nucleic acid is complementary to 5S, 18S, or 28S rRNA, or corresponding genomic DNA.
Claim 5
Dependent Claim
18 words
A nucleotide polymer consisting essentially of the sequence SEQ. ID NO. 1 CGAAGTCGAGGCTTTCAGCATG, or an oligonucleotide complementary thereto.
Claim 6
Dependent Claim
18 words
A nucleotide polymer consisting essentially of the sequence SEQ. ID NO. 1 CGAAGTCGAGGCTTTCAGCATG, or an oligonucleotide complementary thereto.
Claim 7
Dependent Claim
15 words
A probe mix consisting essentially of the sequence CGAAGTCGAGGCTTTCAGCATG and a nucleic acid helper probe.
Claim 8
Dependent Claim
15 words
A probe mix consisting essentially of the sequence CGAAGTCGAGGCTTTCAGCATG and a nucleic acid helper probe.
Claim 9
Dependent Claim
19 words
The probe mix of claim 5, wherein said helper probe is an oligonucleotide having the sequence CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC or TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG.
Claim 10
Dependent Claim
27 words
The probe of claim 1, wherein said probe distinguishes Histoplasma capsulatum from Blastomyces dermatitidis, Arthroaerma tuberculatum, Chrysosporium keratinophilum, Coccidioides immitis, Corynascus sepedonium, Sepedonium chrysospermum, and Scopulariopsis acremonium.
Claim 11
Dependent Claim
28 words
A nucleic acid hybrid formed between an oligonucleotide, consisting essentially of the sequence CGAAGTCGAGGCTTTCAGCATG and a nucleotide polymer sufficiently complementary thereto to allow hybridization under stringent hybridization conditions.
Claim 12
Dependent Claim
28 words
A nucleic acid hybrid formed between an oligonucleotide, consisting essentially of the sequence CGAAGTCGAGGCTTTCAGCATG and a nucleotide polymer sufficiently complementary thereto to allow hybridization under stringent hybridization conditions.
Claim 13
Dependent Claim
43 words
An oligonucleotide consisting essentially of between 10 and 100 nucleotides, inclusive, able to form a hybrid at 60° C. with a nucleotide polymer having a nucleotide base sequence selected from a group consisting of 5' CGAAGTCGAGGCTTTCAGCATG, 5' CATGCTGAAAGCCTCGACTTCG, 5' CAUGCUGAAAGCCUCGACUUCG, or 5' CGAAGUCGAGGCUUUCAGCAUG.
Claim 14
Dependent Claim
43 words
An oligonucleotide consisting essentially of between 10 and 100 nucleotides, inclusive, able to form a hybrid at 60° C. with a nucleotide polymer having a nucleotide base sequence selected from a group consisting of 5' CGAAGTCGAGGCTTTCAGCATG, 5' CATGCTGAAAGCCTCGACTTCG, 5' CAUGCUGAAAGCCUCGACUUCG, or 5' CGAAGUCGAGGCUUUCAGCAUG.
Claim 15
Dependent Claim
16 words
The oligonucleotide of claim 9, wherein said oligonucleotide consists essentially of between 15 to 100 bases.
Claim 16
Dependent Claim
16 words
The oligonucleotide of claim 9, wherein said oligonucleotide consists essentially of between 10 to 50 bases.
Claim 17
Dependent Claim
16 words
The oligonucleotide of claim 9, wherein said oligonucleotide consists essentially of between 20 to 50 bases.
Claim 18
Independent Claim
52 words
A method for distinguishing Histoplasma capsulatum from Blastomyces dermatitidis, Arthroderma tuberculatum, Chrysosporium keratinophilum, Coccidioides immitis, Corynascus sepedonium, Scopulariopsis acremonium, and Sepedonium chrysospermum, comprising the step of hybridizing a nucleic acid hybridization assay probe which is able to hybridize to Histoplasma capsulatum rRNA and not to rRNA from said other species of fungi.
Claim 19
Independent Claim
52 words
A method for distinguishing Histoplasma capsulatum from Blastomyces dermatitidis, Arthroderma tuberculatum, Chrysosporium keratinophilum, Coccidioides immitis, Corynascus sepedonium, Scopulariopsis acremonium, and Sepedonium chrysospermum, comprising the step of hybridizing a nucleic acid hybridization assay probe which is able to hybridize to Histoplasma capsulatum rRNA and not to rRNA from said other species of fungi.
Claim 20
Dependent Claim
52 words
The hybridization assay probe of claim 1, wherein said probe consists essentially of an oligonucleotide having sufficient complementarity to a region of ribosomal nucleic acid which varies between fungi to hybridize to Histoplasma capsulatum and not to Blastomyces dermatitidis, Arthroderma tuberculatum, Chrysosporium keratinophilum, Coccidioides immitis, Corynascus sepedonium, Scopulariopsis acremonium, and Sepedonium chrysospermum.
Claim 21
Dependent Claim
14 words
The probe of claim 7, wherein said probe is complementary to rRNA or rDNA.
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1997-10-03 | 1998-04-04 | 1998-10-04 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 2001-10-03 | 2002-04-04 | 2002-10-04 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 2005-10-03 | 2006-04-04 | 2006-10-04 | $7700.00 | Window Closed / Lapsed |