Yeast hybrid vectors and their use for the production of polypeptides

Claim 2

A DNA fragment comprising a yeast acid phosphatase promoter and flanking sequences, and mutants thereof which retain the promoter function. .

Claim 3

A DNA fragment according to claim 1 comprising the PH03 promoter, and mutants thereof which retain the promoter function.

Claim 4

A DNA fragment according to claim 1 comprising the PH05 promoter, and mutants thereof which retain the promoter function.

Claim 5

A DNA fragment according to anyone of claims 1 to 3 containing whole or part of the signal sequence of the corresponding acid phosphatase protein coding region linked to the yeast acid phosphatase promoter, and mutants thereof which retain the promoter function.

Claim 6

A DNA fragment according to claim 1 having the nucleotide sequence CCCTTAGGCAAACTAGCCGATG and subfragments andmutants thereof which retain the promoter function.

Claim 7

A DNA fragment according to claim 5 selected from the group consisting of the DNA fragment having the nucleotide sequence and the DNA fragment having the nucleotide sequence

Claim 8

A DNA fragment according to claim 1 having the nucleotide sequence and subfragments and mutants thereof which retain the promoter function.

Claim 10

A hybrid vector comprising a yeast acid phosphatase promoter and a yeast or a non-yeast polypeptide coding region which is controlled by said promoter.

Claim 11

A hybrid vector comprising a yeast acid phosphatase promoter and a yeast or a non-yeast polypeptide coding region which is controlled by said promoter.

Claim 12

A hybrid vector according to claim 9, wherein the yeast acid phosphatase promoter is the PH03 promoter.

Claim 13

A hybrid vector according to claim 9 wherein the yeast acid phosphatase promoter is the PH05 promoter.

Claim 14

A hybrid vector according to any one of claims 9 to 11 wherein the yeast or non-yeast polypeptide coding region codes for an enzyme, a hormone, a polypeptide with immunomodulatory, anti-viral or anti-cancer properties, an antibody, a viral antigen, a vaccine or a clotting factor.

Claim 15

A hybrid vector according to claim 12 wherein the yeast or non-yeast polypeptide coding region codes for a human interferon.

Claim 16

A hybrid vector according to claim 13 wherein the yeast or non-yeast polypeptide coding region codes for a human lymphoblastoid interferon.

Claim 17

A hybrid vector according to claim 12 wherein the yeast or non-yeast polypeptide coding region codes for a hepatitis B virus antigen.

Claim 18

A hybrid vector according to any one of claims 9 to 15 including additional DNA sequences derived from the group consisting of a bacterial plasmid, bacteriophage A, yeast 2 µ plasmid and/or yeast chromosomal DNA.

Claim 19

A hybrid vector according to claim 16 including yeast chromosomal DNA containing an autonomously replicating segment and a marker gene.

Claim 20

A hybrid vector according to claim 9 wherein the transcripts coding for the yeast or non-yeast polypeptide end in a DNA sequence containing transcription termination signals of a yeast gene.

Claim 21

A hybrid vector according to claim 18 containing transcription termination signals of the PHO5 gene.

Claim 22

A hybrid vector according to claim 9 wherein the yeast or non-yeast polypeptide coding region is preceded by a signal sequence.

Claim 23

A hybrid vector according to claim 9 wherein the yeast or non-yeast polypeptide coding region is joined to the acid phosphatase promoter region between the major acid phosphatase mRNA start and the ATG of the acid phosphatase coding region.

Claim 24

A hybrid vector according to claim 9 selected from the group consisting of the plasmids p30IFN2(8 ' 1 ), p30IFN2'(8 ' 1 ) and pJDB207/ IFN2'( 8 i) .

Claim 25

A hybrid vector according to claim 9 selected from the group consisting of the plasmids pJDB207/IF(8i), pJDB207/IF2(5 1 ) and pJDB207/IF2(l'b).

Claim 26

A hybrid vector according to claim 9 selected from the group consisting of the plasmids pJDB207/PH05/HBVsD14 and pJDB207/PH05/ HBVsΔ14t.

Claim 27

A hybrid vector according to claim 9 selected from the group consisting of the plasmids pJDB207/IF2(5 1 )Δ72, pJDB207/IF2(5 1 )Δ82, p31R/IF(α-3), p31Y/IF(α-3), p31R/IF(α-2), p31R/IF(α-2)Δ72, p31Y/IF(α-2), p31Y/IF(α-2)Δ72, p31Y/IF(α-2)Δ82, p31E/IF(α-1), p31R/LF(α-1)Δ, p31Y/IF(α-1), p31Y/IF(α-1)Δ, pJDB207Y/IF(a-3), pJDB207R/IF(α-2), pJDB207R/IF(α-2)Δ72,' pJDB207Y/IF(a-2), pJDB207Y/IF(α-2)Δ72, pJDB207Y/IF(α-2)Δ82, pJDB207R/IF(α-1), pTDB207R/IF(α-1)Δ, pJDB207Y/IF(α-1) and pJDB207Y/IF(α-1)Δ.

Claim 28

The hybrid vector p31R/IF(α-2)Δ82 according to claim 9.

Claim 29

The hybrid vector pJDB207R/IF(α-3) according to claim 9.

Claim 30

The hybrid vector pJDB207R/IF(α-2)Δ82 according to claim 9.

Claim 31

29- A method for producing a hybrid vector according to anyone of claims 9 to 28 which method comprises introducing into a vector DNA a yeast acid phosphatase promoter and a yeast or a non-yeast polypeptide coding region which is controlled by said promoter.

Claim 32

A yeast transformed with a hybrid vector according to anyone of claims 9 to 28.

Claim 33

A transformed yeast according to claim 30 selected from a species of the genera Saccharomyces, Schizosaccharomyces or Torulopsis.

Claim 34

A transformed yeast according to claim 31 wherein the yeast is Saccharomyces cerevisiae.

Claim 35

A transformed yeast according to claim 32 selected from the group consisting of saccharomyces cerevisiae RH971/p3OIFN2(8 ' 1 ), Saccharomyces cerevisiae RH971/p30IFN2'(8 ' 1 ) and Saccharomyces cerevisiae PH971/PJDB207/IFN2' (8 ' 1 ).

Claim 36

A transformed yeast according to claim 32 selected from the group consisting of Saccharomyces cerevisiae AH220/pJDB207/IF(8 ' 1 ), Saccharomyces cerevisiae AH220/pJDB207/IF2(5 1 ) and Saccharomyces cerevisiae AH220/pJDB207/IF2(1'b).

Claim 37

A transformed yeast according to claim 32 selected from the group consisting of Saccharomyces cerevisiae AH220/pJDB207/PHO5/ HBVsΔ14 and Saccharomyces cerevisiae AH220/pJDB207/PHO5/HBVsΔ14t.

Claim 38

A transformed yeast according to claim 32 selected from the group consisting of Saccharom y ces cerevisiae AH220/pJDB207Y/ IF(a-3), Saccharomyces cerevisiae AH220/pJDB207/IF2(5 1 )Δ72, Saccharomyces cerevisiae AH220/pJDB207/IF2(5 1 )Δ82, Saccharomyces cerevisiae AH220/pJDB207R/IF(α-2), Saccharomyces cerevisiae AH220/pJDB207R/IF(α-2)Δ72, Saccharomyces cerevisiae AH220/ pJDB207Y/IF(a-2), Saccharomyces cerevisiae AH220/pJDB207Y/ IF(a-2)A72, Saccharomyces cerevisiae AH220/pJDB207Y/IF(α-2)Δ82, Saccharomyces cerevisiae AH220/pJDB207R/IF(α-1), Saccharomyces cerevisiae AH220/pJD8207R/IF(α-1)Δ, Saccharomyces cerevisiae AH220/pJDB207Y/IF(α-1), Saccharomyces cerevisiae AH220/pJDB207Y/ IF(α-1)Δ, Saccharomyces cerevisiae GRF18/pJDB207/IF2(5 1 )Δ72, Saccharomyces cerevisiae GRF18/pJDB207/IF2(5 1 )Δ82, Saccharomyces cerevisiae GRF18/pJDB207Y/IF(a-3), Saccharomyces cerevisiae GRF18/pJDB207R/IF(α-2), Saccharomyces cerevisiae GRF18/pJDB207R/ IF(α-2)Δ72, Saccharomyces cerevisiae GRF18/pJDB207Y/IF(α-2), Saccharomyces cerevisiae GRF18/pJD8207Y/IF(α-2)Δ72, Saccharomyces cerevisiae GRF18/pJDB207Y/IF(α-2)Δ82, Saccharomyces cerevisise GRF18/pJDB207R/IF(α-1), Saccharomyces cerevisiae GRF18/pJD8207R/ IF(a-l)A, Saccharomyces cerevisiae GRF18/pJDB207Y/IF(α-1) and Saccharomyces cerevisiae GRF18/pJD8207Y/IF(α-1)Δ.

Claim 39

The transformed yeast Saccharomyces cerevisiae AH220/pJD8207R/ IF(a-3) according to claim 32.

Claim 40

The transformed yeast Saccharomyces cerevisiae AH220/pJDB207R/ IF(α-2)Δ82 according to claim 32.

Claim 41

The transformed yeast Saccharomyces cerevisiae GRF18/pJDB207R/ IF(a-3) according to claim 32.

Claim 42

The transformed yeast Saccharomyces cerevisiae GRF18/pJDB207R/ IF(α-2)Δ82 according to claim 32.

Claim 43

A method for producing a transformed yeast according to claim 3 0 , which comprises transforming yeast with a hybrid vector according to anyone of claims 9 to 28,

Claim 45

A method for producing a yeast or non-yeast polypeptide according to claim 42, characterized in that the transformed yeast is cultured in a nutrient medium containing assimilable sources of carbon and nitrogen and inorganic salts.

Claim 46

A method for producing a yeast or non-yeast polypeptide according to claim 43, wherein the transformed yeast contains a hybrid plasmid-comprising the PH05 promoter.

Claim 47

A method for producing a yeast or non-yeast polypeptide according to claim 44, wherein the nutrient medium contains low concentration or inorganic phosphate.

Claim 48

A method according to claim 42, wherein the polypeptide is an enzyme, a hormone, a polypeptide with immunomodulatory, anti-viral or anti-cancer properties, an antibody, a viral antigen, a vaccine or a clotting factor.

Claim 49

A method according to claim 46, wherein the polypeptide is a human interferon.

Claim 50

A method according to claim 47, wherein the human interferon is a human lymphoblastoid interferon.

Claim 51

A method according to claim 48, wherein the human lymphoblastoid interferon is IFN-a-1.

Claim 52

A method according to claim 48, wherein the human lymphoblastoid interferon is IFN-a-2.

Claim 53

A method according to claim 48, wherein the human lympho- biastoid interferon is IFN-a-3.

Claim 54

A method according to claim 46, wherein the polypeptide is a hepatitis B virus antigen.

Claim 55

A method according to claim 52, wherein the polypeptide is hepatitis B virus surface antigen.

Claim 56

A hybrid vector consisting of a yeast acid phosphatase promoter and additional DNA sequences derived from the group consisting of a bacterial plasmid, bacteriophage λ, yeast 2 p plasmid and/or yeast chromosomal DNA.

Claim 57

A hybrid vector consisting of a yeast acid phosphatase promoter and additional DNA sequences derived from the group consisting of a bacterial plasmid, bacteriophage λ, yeast 2 p plasmid and/or yeast chromosomal DNA.

Claim 58

A hybrid vector according to claim 54,wherein the yeast acid phosphatase promoter is the PH05 promoter.

Claim 59

A hybrid vector according to claim 55 selected from the group consisting of the plasmids p31, p31/R and p31/Y.